Haplogroup G-L293
| Haplogroup G2a1 | |
| Possible time of origin | perhaps 3,000 years BP |
| Possible place of origin | perhaps southern Caucasus Mtns. |
| Ancestor | Haplogroup G2a (P15) |
| Descendants | G2a1a |
|---|---|
| Defining mutations | {{{mutations}}} |
In human genetics, Haplogroup G2a1 (L293) is a Y-chromosome haplogroup. It is a branch of haplogroup G (Y-DNA) (M201), and more specifically of haplogroup G2 (P287) and most specifically of haplogroup G2a (P15). Haplogroup G2a1 has an extremely low frequency in almost all populations except in the area of the Caucasus Mountains.
Genetic features of haplogroup G2a1
Almost all G2a1 persons have a value of 10 at short tandem repeat (STR) marker DYS392. The major G2a1 subgroup typically has higher values for DYS385b, such as 16, 17 or 18, than seen in most G persons. Almost all G2a1a persons have a value of 15 or more at DYS385a, a finding which can be helpful in distinguishing G2a1a persons from non-G persons with similar marker values. In addition, the G2a1a persons tested were found to have a value of 9 at marker DYS505. This is several values below what is found in G subgroups, and is potentially the basis of additional subgrouping.
L293 which defines G2a1 is a SNP first identified at Family Tree DNA in 2011, and in 2012 was determined to encompass P16 positive persons. L293 is found at chromosome position 10595022 and represents a mutation from G to C. The forward primer is GTCCAGCTCATATGTCTTCAG, and the reverse primer is GACTTTCAACTTCTTACGGCTG.[1] Under usual circumstances subgroup G2a1a persons would also have the distinctive mutation at SNP P16 that characterizes G2a1a. The reliability of P16 in identifying everyone who should be P16+ has been questioned.[2] Because there are two strands involved, P16 results can be reported as P16.1 and P16.2, and persons may have varying results for components of the SNP. The P designation in P16 indicates it was identified at the University of Arizona, and P16's existence was first reported in 2000.[3] These are the specifications listed for P16: located on the Y chromosome at 19434578; 19128376.....forward primer is aggctccatctgtagcacac.....reverse primer is taaccttatagaccaaccccg...the mutation is a change from A to T.[4]
Dating of G2a1 origin
The only published study to date P16 (G2a1a) argues it is about 9,600 years old.[5] This dating methodology is not universally accepted.[6]
G2a1 subgroups
G2a1a (P16+) and G2a1a1 (P18+)
The presence of the SNP P16 mutation characterizes G2a1's only SNP subgroup, G2a1a. But it is difficult to distinguish P16 from its own P18 subgroup. The reliability of P16 in identifying everyone in its G2a1a category has been questioned.[2] As to P18, because individual strands are examined, P18 can be classified as P18.1, P18.2 and P18.3, and persons may have varying results for three components. The P designation indicates it was identified at the University of Arizona, and its existence was first reported in 2002.[7] The technical specifications for P18 are that it is: located on the Y chromosome at 25751219; 25029753; 23396005....forward primer is tggatctgattcacaggtag....reverse primer is ccaacaatatgtcacaatctc.....the mutation is a change from C to T.[4]
Other G2a1a genetic clusters
Due to the unreliability of the SNP testing for this haplogroup, it can be difficult to validate whether identificable clusters of men belong to G2a1a or instead to G2a1a1. The most common cluster based on STR marker values of G2a1a men who report ancestry in the Caucasus Mountains region has the value of 9 at STR marker DYS391 and 19,21 at marker YCA. Significant other smaller G2a1a Caucasus clusters with 10 or 11 at DYS391 also exist.
The Ashkenazi Jewish G2a1a men with northeastern European origins almost all have YCA values of 21,21 and a DYS19 value of 16. More variation in values is seen in the Caucasus samples than the Ashkenazi samples, suggesting an older common ancestor in the Caucasus than among the Jews.
Other G2a1a men reporting eastern European ancestry form a cluster with YCA values of 19,21 without the other distinctive values seen in the other two clusters.
About half of the available G2a1a/G2a1a1 samples do not reliably belong to any of these three clusters. In addition, the STR markers mentioned are prone to further mutations and are not as reliable as SNPs in identifying all the persons who share a common male ancestor.
Finally, there are lesser numbers of G2a1 men who are negative for P16. It is unclear whether their ancestors may have ever had the P16 mutation. Many of these men have a very unusual 13,21 value for marker YCA and are predominantly Hispanic.
Geographic distribution
G2a1a and its one subgroup represent the majority of haplogroup G samples in some parts of the Caucasus Mountains area. G2a1a is found only in tiny numbers elsewhere. A recent article by Balanovsky et al.[8] provided the first detailed testing of P16 and P18 in this region.
Almost all P16 samples also had the P18 mutation. The highest percentage of P18 was found among Ossetians of Russia's Republic of North Ossetia–Alania, representing 32% of all samples there. Among Abkhazians of Abkhazia, P18 was 16% of total samples, and it was 8% of Circassians (Adyghe) in Russia's Republic of Karachay–Cherkess. Elsewhere in the Caucasus, P16 and P18 were negligible or represented a small percentage. The southeastern Caucasus area was not sampled.
There are isolated samples of G2a1a men with reported ancestry in Georgia, Turkey, Bulgaria, western Russia, Libya, and England with similarities to those of a North Ossetian cluster based on STR marker values. The Svans and South Ossetians within Georgia have significant G2a1a presence though no one has yet quantified the percentage. Likewise closely related to a Jewish cluster based on STR marker values is an anonymous sample in the SMGF database from Kashgar, China,[9] as well as isolated samples from Lebanon, Cyprus, Armenia and the Austrian Tyrol. The mostly eastern European YCA=19,21 subgroup includes an anonymous sample in the SMGF database [9] from Kyrgyzstan, and another sample from among the Svans of Georgia exists.
There are also isolated samples that do not belong to any cluster from the major countries of central, eastern and southern Europe, from Morocco, the northern Middle East, the Caucasus region and Iran.[10] The sample from Iran (Tehran) represents only 1 of the 444 Iranian samples of all types in the YHRD database. Possibly of significance—unlike some other G subgroups—G2a1 samples from southern Asia do not seem to exist.[11] In contrast, among the Romani of Hungary many of the available haplogroup G samples have STR marker features typical of G2a1a.[12]
Geographical origins of haplogroup G2a1
The exceptionally high level of G2a1a in the North Ossetians has attracted attention and speculation. Since the Ossetians make claim to descent from the Alans, a group of Sarmatians, it was thought that the Alans or their predessor residents of the area north of the Caucasus, the Scythians, must also have been high in Haplogroup G. In addition, a possible connection to the Alans was of interest because certain areas of Europe have a distribution of haplogroup G incorresponding to those to which large numbers of Alans and other Sarmatians migrated.
The type of haplogroup G in these European areas, however, is not G2a1a which is rare in Europe. Also rare in Europe is the type of G (G2a3b1) common among the Kabardinians and Adyghe and Abkhaz of the western Caucasus adjacent to the Ossetians.
If the Ossetian G2a1a originated in the major groups north of the Caucasus sometime during an approximate 2,000-year period, it would have been sequentially either from the Scythians, the Alans (and other Saramatians) or the Huns. All three groups were described north of the Caucasus in different time periods as they migrated from the east. Examination of ancient DNA from Scythian skeletons from the steppes to the east of the Caucasus has found only haplogroup R1a.[13][14] The Sarmatians subsumed the Scythians. Then many of the Sarmatians migrated westward into Europe. Then the Huns occupied the area north of the Caucasus prior to their own migration farther westward involving large numbers of men. Finally, the Mongols in their migration into the area north of the Caucasus forced what are thought to be the ancestors of modern Ossetians southward down to the edge of the mountains.
These three groups that occupied the area to the north of the Caucasus had language and cultural similarities. But they were also considered just confederations of various tribes. Sarmatians in particular were known readily to accept other groups into their numbers.[15] Because all three groups were also nomadic and often relocating in mass migrations, it is conceivable they vacated the last residence leaving little genetic trace of their occupation within the next occupants.
Only the Scythians were mentioned in historical records as having a connection south of the Caucasus where significant concentrations of haplogroup G exist. Greek historian Diodorus Siculus related that the Scythians had carried Medes to the River Don north of the Caucasus presumably from today's northwestern Iran, this event giving rise to their name Sauromatians.[16] Scythians had occupied Media 653-625 BCE. Pliny also suggested Sarmatians descended from Medes.[17] But historians have difficulty explaining how the Sarmatians instead seemed to come from central Asia off to the east in their occupation of Scythian lands around the 5th century BCE. The Median lands were primarily in northwestern Iran, and the G samples found there do not resemble the types or patterns seen in the Caucasus.
In the Nasidze study of Y-DNA in various Caucasus groups,[18] he concluded that the groups north of the Caucausus are closer genetically to each other than to persons south of the Caucasus. But he used only brief STR marker samples, and more samples and more detailed ones are now available.[19] These latter samples indicate the G2a1a found in the North Ossetians is most frequently found also south of the Caucasus and rarely elsewhere.
If a concentration of G2a1a points to the location of its origin, the north and south Caucasus region would be the likely location of origin. However, the first ancestors who were G2a1a could have been small in number, and a relocation from elsewhere is possible. The most important factor in determining G2a1a origins is knowing from where the North Ossetians came. Because of the confederation nature of the Alans, it is possible the Ossetian ancestors were part of those Alans who did not participate in the Great Migration. But it also seems plausible that the pre-Alan ancestors of the North Ossetians arrived there from south of the Caucasus where G is found in significant numbers and with the diversity seen in a longtime presence. The G in the area to the north of the Caucasus lacks both features. Two studies published in 2011[8][20] and one in 2012[5] argued that persons of the Caucasus had their origin in lands to the south.
Famous members
Joseph Stalin, from genetic testing of his grandson (his son Vasily's son; Alexander Burdonsky) belongs to haplogroup G2a1a1.[21] The STR marker value combinations for him are typical of those seen primarily in the Caucasus region.[22]
References
- ^ |URL=http://ytree.ftdna.com/index.php?name=Draft&parent=root
- ^ a b |url=http://archiver.rootsweb.ancestry.com/th/read/GENEALOGY-DNA/2007-07/1185576938
- ^ Hammer, M. et al. (June 2000). "Jewish and Middle Eastern non-Jewish populations share a common pool of Y-chromosome biallelic haplotypes". Proc Natl Acad. Sci. USA 97 (12): 6769–74. Bibcode:2000PNAS...97.6769H. doi:10.1073/pnas.100115997. PMC 18733. PMID 10801975.
- ^ a b Karafat, T., et al. (2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research 18 (5): 830–38. doi:10.1101/gr.7172008. PMC 2336805. PMID 18385274.
- ^ a b Rootsi et al.; Myres, N.; Lin, A.; Jarve, M.; King, R.; Kutuev, I.; Cabrera, V.; Khusnutdinova, E.; Varendi, K.; Sahakyan, H.; Behar, D.; Khusainova, R.; Balanovsky, O. (May 2012). "Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the populations of Europe and the Caucasus". European Journal of Human Genetics: 1–8. doi:10.1038/ejhg.2012.8. PMID 22588667. Text "e-pub ahead of print " ignored (help)
- ^ url= http://dienekes.blogspot.com/2010/05/accuracy-of-molecular-dating-with-rho.html and http://dienekes.blogspot.com/2008/07/how-y-str-variance-accumulates-comment.html
- ^ The Y Chromosome Consortium (2002). "A Nomenclature System for the Tree of Human Y-Chromosomal Binary Haplogroups". Genome Research 12 (2): 339–48. doi:10.1101/gr.217602. PMC 155271. PMID 11827954.
- ^ a b Balanovsky et al.; Dibirova, K.; Dybo, A.; Mudrak, O.; Frolova, S.; Pocheshkhova, E.; Haber, M.; Platt, D. et al. (Oct 2011). "Parallel evolution of genes and language in the Caucasus region". Molecular Biology and Evolution 28 (10): 2905–20. doi:10.1093/molbev/msr126. PMID 21571925.
- ^ a b url|=http://www.smgf.org/pages/ydatabase.jspx
- ^ name=https://sites.google.com/site/haplogroupgproject/project-roster
- ^ |url=https://sites.google.com/site/haplogroupgproject/project-roster Haplogroup G Project Samples - G2a1/G2a1a
- ^ |url=http://www.yhrd.org/Search
- ^ Keyser C, et al. (May 2009). "Ancient DNA provides new insights into the history of south Siberian Kurgan people". Hum. Genet. 126 (3): 395–410. doi:10.1007/s00439-009-0683-0. PMID 19449030.
- ^ Bouakaze C, Keyser C, Amory S, Crubézy E, Ludes B (November 2007). "First successful assay of Y-SNP typing by SNaPshot minisequencing on ancient DNA". Int. J. Legal Med. 121 (6): 493–9. doi:10.1007/s00414-007-0177-3. PMID 17534642.
- ^ Bachrach, Bernard S., A History of the Alans in the West. Univ of Minn. Press, 1973, p.18
- ^ Diodorus Siculus, Bibliotheca Historica, Lib. II, 43, p 29. |url=http://penelope.uchicago.edu/Thayer/E/Roman/Texts/Diodorus_Siculus/2B*.html
- ^ Pliny, Natural History, VI, ch 7, W. H. Jones, transl., Wm. Heinemann, London, 1949-54
- ^ Nasidze I, et al. (November 2004). "Genetic evidence concerning the origins of South and North Ossetians". Ann. Hum. Genet. 68 (Pt 6): 588–99. doi:10.1046/j.1529-8817.2004.00131.x. PMID 15598217.
- ^ url=https://sites.google.com/site/haplogroupgproject/project-roster
- ^ Yunusbayev et al.; Metspalu, M.; Järve, M.; Kutuev, I.; Rootsi, S; Metspalu, E.; Behar, D.; Varendi, .K; Sahakyan, H.; Khusainova first10=R. last11=Yepiskoposyan (Jan 2011). "The Caucasus as an asymmetric semipermeable barrier to ancient human migrations". Molecular Biology and Evolution 29 (1): 359–65. doi:10.1093/molbev/msr221. PMID 21917723.
- ^ |url=http://www.runewsweek.ru/theme/?tid=96&rid=1567
- ^ |url=https://sites.google.com/site/haplogroupgproject/project-roster
